The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics

Tingzhen Wang; Zhenxing Wu; Jianjian Chen; Fangjian Li; Guihua Lv

doi:doi:10.11648/j.aff.20241306.11

Research Article |

| Peer-Reviewed

The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics

Tingzhen Wang

, Zhenxing Wu, Jianjian Chen, Fangjian Li, Guihua Lv^*

Published in Agriculture, Forestry and Fisheries (Volume 13, Issue 6)

Received: 8 October 2024 Accepted: 11 November 2024 Published: 21 November 2024

Views: Downloads:

Download PDF

Share This Article

Twitter
Linked In
Facebook

Abstract

Sweet corn is a vegetable and grain dual-use crop with high economic value and industrial advantages. Low temperature stress significantly reduces the germination rate of sweet corn seeds, which has a negative impact on both quality and yield. This study used the chilling sensitive sweet corn inbred line 20hi111 and the chilling tolerant sweet corn inbred line T135 as experimental materials to measure the MDA (malondialdehyde) and H₂O₂content, CAT, POD, and SOD enzyme activities, and enzyme gene expression patterns during seed germination under low temperature (10°C) and normal temperature (25°C) treatments. The research results indicated that during low-temperature germination, the H₂O₂ content and CAT activity of 20hi111 were generally higher than those of T135, while the POD and SOD activities and MDA content were generally lower than those of T135. There was no strict consistency between gene expression and enzyme activity. At low temperature, the expression of ZmCAT1 and ZmCAT3 in 20hi111 was significantly higher than T135, while there was no significant difference in ZmPOD1. In 20hi111, ZmPOD3 was first lower and then higher than T135, and ZmSOD3 and ZmSOD9 were lower than T135 under low temperature treatment. In this study, the activity of antioxidant enzymes and the expression of antioxidant enzyme-related genes in sweet corn inbred lines with different germination characteristics under low temperature were analyzed, which provided some theoretical basis for cultivating sweet corn varieties with low temperature tolerance.

Published in	Agriculture, Forestry and Fisheries (Volume 13, Issue 6)
DOI	10.11648/j.aff.20241306.11
Page(s)	224-234
Creative Commons	This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.
Copyright	Copyright © The Author(s), 2024. Published by Science Publishing Group

Keywords

Sweet Corn, Germination, Low Temperature, Antioxidant Enzyme Activity

1. Introduction

Sweet corn (Zea mays convar. saccharata) is widely planted worldwide and is a new crop that integrates vegetables, fruits, grains, and feed

[1]

. As sweet corn is a warm loving crop, its growth and development process are sensitive to low temperature

[2]

. Due to the short growth cycle and high multiple cropping index of sweet corn, people usually choose staggered planting in order to increase economic value. Therefore, early spring, late autumn, and winter planting will be affected by low temperature, resulting in seedling shortages, dead seedlings, weak growth, and other phenomena, affecting yield and quality

[3, 4]

. It is of great significance in production to study the low-temperature germination of sweet corn.

Low temperature stress can disrupt the balance of reactive oxygen species and normal metabolic system in cells during the early stages of crop germination, affecting the germination process of seeds

[5]

. The antioxidant pathway, as one of the important regulatory mechanisms for improving crop tolerance to low temperature stress, reduces the damage of cell membranes to reactive oxygen species (ROS) by regulating the production and activity of antioxidant enzymes

[6]

. The enzymatic defense system in plants includes antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), which can directly or indirectly regulate the production and elimination of ROS

[7]

. The decrease in temperature causes changes in the activity and quantity of antioxidant enzymes in corn, leading to an imbalance in ROS content and affecting plant growth and development. Studies have shown that low temperatures can increase the content of antioxidant enzymes in maize, but decrease enzyme activity, and there are significant differences among different varieties

[8]

. The effect of low temperature on sweet corn is much greater than that on glutinous corn, and the activities of SOD and POD are significantly reduced

[9]

. The transcription levels of antioxidant enzymes in two different genotypes of maize under low temperature stress were measured. The results showed that the expression of key antioxidant enzymes in maize varieties tolerant to low temperature stress was significantly enhanced under low temperature conditions to cope with environmental discomfort

[10]

In our preliminary research, we conducted low-temperature germination experiments on 100 sweet corn inbred lines and ultimately selected a chilling sensitive inbred line 20hi111 and a chilling tolerant inbred line T135. The germination rate of 20hi111 is as high as 92.2% under room temperature treatment (RT), but it does not germinate under low temperature treatment (LT). T135 has a germination rate of 100% under RT and the highest germination rate among 100 inbred lines under LT, reaching up to 94.4%. Meanwhile, through whole genome association analysis, we have identified several genes related to antioxidant activity that may play a role in the temperature tolerant germination of sweet corn

[11]

. On this basis, we conducted physiological indicators related to the antioxidant enzyme system on two sweet corn inbred lines with different germination characteristics in this study, and measured the expression pattern of antioxidant enzyme genes, in order to explore the physiological and molecular mechanisms of low-temperature germination of sweet corn and provide technical reference for the development and production of chilling tolerant sweet corn varieties.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Sweet corn inbred line T135 and 20hi111 were used as the experimental materials. Seeds of consistent size and plump grain shape are selected. After soaking and disinfecting in 0.2% NaCl solution for 20 minutes, the seeds were rinsed clean with distilled water. Thirty seeds from each inbred line were placed in sterile culture dishes with three layers of filter paper, and then place them in artificial climate chambers at 10°C (low temperature) and 25°C (room temperature) under dark conditions. An appropriate amount of distilled water was regularly added. Each process was repeated three times. At room temperature, samples were taken on days 0, 1, 2, 3, and 4 after germination began. And at low temperature, samples were taken on days 0, 1, 3, 5, 7, 10, and 14 after germination began. Approximately 3g of seeds were collected each time, which were repeated three times and were stored at -80°C for subsequent experiments.

2.2. Extraction of Total RNA and Quantitative Real-time PCR Analysis (qRT-PCR)

ZmSOD3, ZmSOD9, ZmPOD1, ZmPOD3, ZmCAT1, and ZmCAT3 are six antioxidant enzyme genes screened by transcriptome sequencing

[12]

. Samples were taken at 0, 1, 3, and 5 days after germination at 10°C (low temperature) and 25°C (room temperature) for qRT-PCR detection. Quick RNA Isolation kit (Huayueyang Biotech, Beijing, China) and TransScript® Uni All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) were used for total RNA extraction and reverse transcription synthesis of cDNA. Primer 5.0 was used for primer design (Table 1). qRT-PCR was carried out with Taq Pro Universal SYBR qPCR Master Mix (Vazyme Bio, Nanjing, China) and the QuantStudio 5 Real-Time PCR Instrument (Thermo Fisher Scientific, Waltham, MA, USA). The amplification programs were 95°C for 30 s, followed by 40 cycles at 95°C for 10 s, 60°C for 10 sec, and 72°C for 15 s. Zmubiquitin2 was used as internal reference gene. The 2^-ΔΔCT method was used as data analysis.

Table 1. The primer list.

Primer name	Primer sequence (5'-3')
qubi2-F	TGGTTGTGGCTTCGTTGGTT
qubi2-R	GCTGCAGAAGAGTTTTGGGTACA
qZmCAT1-F	GAGATCCAAATGGTACGGTATT
qZmCAT1-R	CAGGCTGTCGTGAGAAGTGC
qZmCAT3-F	GGGAGAAGGCAACCATAC
qZmCAT3-R	TGGGTGTCCGAGCGAGT
qZmPOD1-F	GCCTCCACTTCCACGACT
qZmPOD1-R	CTTCTTCTCCGACAACCAGC
qZmPOD3-F	CATCATCGGTGGCACTAAC
qZmPOD3-R	ACTTTCAGGACCAAGTTTGC
qZmSOD3-F	TTTGGTTCATTTGAGGCACT
qZmSOD3-R	CTCCCAGATCAATCCC
qZmSOD9-F	CGGAGACATCGTGAAATAAA
qZmSOD9-R	CCACAAAGCACATCGAAAC

2.3. Determination of SOD, CAT, POD Activity, and MDA, H₂O₂ Content

The determination of enzyme activities and substance contents related to the antioxidant system were carried out using reagent kits (Soleibao Biotechnology Co., Ltd., Beijing, China). The determination of SOD was carried out using a superoxide dismutase (SOD) activity detection kit (Item number: BC0175). The determination of CAT was carried out using a Catalase (CAT) detection kit (Item number: BC0205). The determination of POD was carried out using a Peroxidase (POD) detection kit (Item number: BC0095). The determination of MDA was carried out using a Malondialdehyde (MDA) content detection kit (Item number: BC0025). The determination of H₂O₂ was carried out using a Hydrogen peroxide (H₂O₂) content detection kit (Item number: BC3595). According to the manufacturer’s instructions, the sample was weighed 1g, added with 10mL of extraction solution, homogenized in an ice bath, centrifuged at 8000g for 1 minute at 4°C, and the supernatant was taken. Reagents were added to a 96 well plate according to the steps in the kit, using a microplate reader to read the absorbance values at the wavelengths corresponding to each indicator, and calculate the CAT, POD, SOD enzyme activities and MDA, H₂O₂ content based on the absorbance values.

3. Results

3.1. The Effect of Chilling on H₂O₂ Content and CAT Activity During the Germination of Sweet Corn Seeds

The 20hi111 is a chilling-sensitive sweet corn inbred line, while T135 is a chilling-tolerant sweet corn inbred line. Under RT (room temperature treatment), the H₂O₂ content of 20hi111 and T135 first decreased and then increased, both of which began to rise on the second day. The H₂O₂ content of T135 was higher than 20hi111 on days 2 and 3, lower than 20hi111 on days 0 and 4, and showed no difference on day 1. Under LT (low temperature treatment), the H₂O₂ content of 20hi111 and T135 also decreased first and then increased, both starting to rise on the 7^th day. The H₂O₂ content of T135 showed no difference compared to 20hi111 before the 5^th day, but significantly increased from the 7^th day onwards (Figure 1A).

Under RT, the CAT activity of 20hi111 and T135 first increased and then decreased. Overall, the CAT activity of 20hi111 was higher than that of T135, only lower on the second day. Under LT, the CAT activity of 20hi111 and T135 gradually increased, with 20hi111 being significantly higher than T135. It can be summarized that the H₂O₂ content and CAT activity increased with prolonged germination time, with significantly higher levels observed in 20hi111 compared to T135 (Figure 1B). Interestingly, we found that the H₂O₂ content and CAT activity in 20hi111 were both higher than those in T135, which may be related to the promotion of CAT activity by H₂O₂.

Download: Download full-size image

Figure 1. H₂O₂ content and CAT activity during seed germination of T135 and 20hi111 sweet corn inbred lines under RT and LT. RT: room temperature treatment (25°C). LT: Low temperature treatment (10°C). (A) Determination of H₂O₂ content. (B) Determination of CAT activity. Standard error is indicated. Asterisks represent Student’s t test significance compared with the control (^*P <0.05, ^**P <0.01).

3.2. The Effect of Chilling on POD, SOD Activity and MDA Content During the Germination of Sweet Corn Seeds

Whether under RT or LT, POD activity first increased, then decreased, and then increased in both 20hi111 and T135, with T135 being significantly higher than 20hi111. Under RT, POD activity increased on the first day, decreased slightly on the second and third days compared to the first day, and strongly increased on the fourth day. Under LT, POD activity increased on the first day, slightly decreased on the second day, and began to rise sharply on the seventh day (Figure 2A). For SOD activity, whether under RT or LT, it slowly increased with the extension of germination time, and the activity of T135 was significantly higher than that of 20hi111 (Figure 2B). Under RT, the MAD content first decreased and then increased in 20hi111, gradually increased in T135, and was significantly higher in 20hi111 than in T135. Under LT, the MDA content first decreased and then increased in 20hi111 and T135, with a significant increase in 20hi111 compared to T135 (Figure 2C).

Standard error is indicated. Asterisks represent Student’s t test significance compared with the control (*p<0.05,**P<0.01).

Download: Download full-size image

Figure 2. POD, SOD activity and MDA content during seed germination of T135 and 20hi111 sweet corn inbred lines under RT and LT. (A) Determination of POD activity. (B) Determination of SOD activity. (C) Determination of MDA content.

3.3. The Effect of Chilling on CAT Gene Expression During the Germination of Sweet Corn Seeds

The expression of ZmCAT1 and ZmCAT3 were basically the same, and the overall expression level increased after germination. On the 0^th day of treatment, there was no significant difference among the four groups, which named 20hi111-25°C, T135-25°C, 20hi111-10°C, and T135-10°C. After one day of treatment, significant differences were observed among the four groups. ZmCAT1 and ZmCAT3 had the highest expression levels in 20hi111-10°C, followed by T135-10°C, and the lowest expression levels in T135-25°C and 20hi111-25°C (Figure 3A, B). In summary, the expression of CAT genes was higher under LT than under RT, and was also higher in 20hi111 than in T135.

Download: Download full-size image

Figure 3. The expression patterns of CAT genes during seed germination of T135 and 20hi111 sweet corn inbred lines under RT (25°C) and LT (10°C). (A) The expression pattern of ZmCAT1. (B) The expression pattern of ZmCAT3. Different letters represent significant differences as determined using one-way ANOVA followed by Duncan’s test (P <0.05).

3.4. The Effect of Chilling on POD Gene Expression Patterns During the Germination of Sweet Corn Seeds

During the treatment, the expression level of ZmPOD1 showed a gradual increase in 20hi111-25°C, and showed an initial increase followed by a decrease in T135-25°C, 20hi111-10°C, and T135-10°C. On the 0^th day of treatment, there was no significant difference among the four groups. After one day treatment, the expression level was highest at T135-25°C, followed by 20hi111-10°C and T135-10°C, and was lowest at 20hi111-25°C. On the 3^th day, the expression level was still highest at T135-25°C, and there was no significant difference observed at 20hi111-10°C, T135-10°C, and 20hi111-25°C. On the 5^th day, the expression level was highest at 20hi111-25°C, followed by T135-25°C, and 20hi111-10°C and T135-10°C showed no significant difference (Figure 4A).

During the treatment, the expression level of ZmPOD3 showed a gradual increase in 20hi111-25°C, T135-25°C, and 20hi111-10°C, and showed an initial increase followed by a decrease in T135-10°C. On the 0^th day, there was no significant difference among the four group. On the 1^th day, the expression levels of T135-10°C, 20hi111-10°C, and T135-25°C increased, with the highest expression level observed at T135-10°C. And there was no difference in expression between 20hi111-10°C and T135-25°C. On the 3^th day, the expression level was highest at T135-10°C and 20hi111-10°C, and was still lowest at 20hi111-25°C. On the 5^th day, the expression level of 20hi111-10°C suddenly increased, and it was the highest among the four groups. On the contrary, the expression level of T135-10°C sharply decreased to the lowest among the four groups (Figure 4B). The expression patterns of ZmPOD1 and ZmPOD3 were not exactly the same. Overall, the expression of POD gene in T135 was slightly higher than that in 20hi111.

Download: Download full-size image

Figure 4. The expression patterns of POD genes during seed germination of T135 and 20hi111 sweet corn inbred lines under RT (25°C) and LT (10°C). (A) The expression pattern of ZmPOD1. (B) The expression pattern of ZmPOD3. Different letters represent significant differences as determined using one-way ANOVA followed by Duncan’s test (P <0.05).

3.5. The Effect of Chilling on SOD Gene Expression Patterns During the Germination of Sweet Corn Seeds

The ZmSOD3 expression showed a trend of first increasing and then decreasing in all four groups. On the 0^th day, the expression level of ZmSOD3 was significantly higher in T135 than in 20hi111. On the 1^th day, the expression levels of all four groups increased, but there was no significant difference between the four groups. On the 3^th day, the expression levels of T135-10°C and 20hi111-10°C increased significantly, showing the highest expression level at T135-10°C, followed by 20hi111-10°C. And the expression level at 20hi111-25°C was significantly higher than that at T135-25°C. On the 5^th day, the expression level sharply decreased. The order of expression level was as follows: T135-10°C, 20hi111-10°C, T135-10°C, and 20hi111-10°C (Figure 5A).

The expression level of ZmSOD9 showed a gradual increase in 20hi111-25°C, T135-25°C, and 20hi111-10°C, and showed an initial increase followed by a decrease in T135-10°C. There was no significant difference between the four groups on the 0^th and 5^th day. On the 1^th and 3^th day, the order of expression level was as follows: T135-10°C, T135-25°C, T135-25°C, and 20hi111-10°C (Figure 5B). Overall, the expression of SOD gene under LT was significantly higher than that under RT, and the expression level in T135 was significantly higher than that in 20hi111.

Download: Download full-size image

Figure 5. The expression patterns of SOD genes during seed germination of T135 and 20hi111 sweet corn inbred lines under RT (25°C) and LT (10°C). (A) The expression pattern of ZmSOD3. (B) The expression pattern of ZmSOD9. Different letters represent significant differences as determined using one-way ANOVA followed by Duncan’s test (P <0.05).

4. Discussion

Sweet corn has thin skin, high sugar content, and good palatability, which are attributed to the absence of genes that convert sugar into starch in the endosperm

[13]

. Although these characteristics are beneficial for commercialization for human consumption, they hinder the production of high-quality seeds due to the lack of starch, reduced skin thickness, and high sugar content, making seeds less prone to germination, and more susceptible to mechanical damage, biological invasion, and spoilage

[14, 15]

. Under this premise, if sweet corn is sown at low temperatures, it will further exacerbate the poor germination rate

[16]

. Low temperature stress is one of the main abiotic stresses that limit plant productivity growth and geographical distribution

[17]

. Plants can increase antioxidant enzyme activity to eliminate excessive reactive oxygen species in the body when subjected to low temperature stress

[18, 19]

. MDA is a membrane permeable substance that is a product of membrane lipid oxidation. Its content can indicate the strength of plant cold resistance

[20]

. This study first detected the content of H₂O₂ and MDA, and found that the content in the low-temperature sensitive sweet corn inbred line 20hi111 was significantly higher than that in the low-temperature tolerant T35 sweet corn inbred line (Figure 1A, Figure 2C). The content of H₂O₂ and MDA showed a trend of first decreasing and then increasing during germination, accompanied by an increase and then decrease in enzyme activities such as CAT and POD (Figures 1, 2). This is consistent with previous studies, where an increase in MDA content is usually accompanied by an enhancement in enzyme activity. In the early stage, antioxidant enzyme activity is strong and has a certain clearing effect on oxidative products. As the low temperature time prolongs, oxidative products accumulate, and high MDA content will in turn inhibit the activity of these oxidases

[21]

. H₂O₂ and MDA showed the same trend. Research showed that at low concentrations, reactive ROS act as second messengers corresponding to extracellular signal transduction from membrane receptors and intracellular regulatory systems. However, when the level of reactive oxygen species increases above a certain threshold, oxidative stress response can accompany cell survival processes, which is harmful to cells

[22, 23]

. Therefore, it can be seen from the MDA and H₂O₂ content that T135 has stronger cold resistance than 20hi111.

SOD is the first line of defense for plants involved in low temperature stress, converting superoxide anions into H₂O₂, which is further converted into water and oxygen using CAT and POD

[24]

. There are 11 different mRNA transcripts of 4 types of SODs in maize, with SOD3 encoding mitochondrial Mn-SOD and SOD9 encoding leaf green Fe-SOD

[25]

. Overexpression of SOD gene can significantly improve plant cold tolerance

[26, 27]

. Whether at room temperature or low temperature, the SOD content in T135 is always higher than that in 20hi111 (Figure 2B), and the overall expression levels of ZmSOD3 and ZmSOD9 are always higher than that in 20hi111 in T135 (Figure 5). The high activity and gene expression level of ZmSOD may be one of the reasons for T135's low-temperature germination tolerance.

For POD, the POD activity in T135 was always higher than that in 20hi111. During germination, POD activity showed a trend of first increasing, then decreasing, and then rapidly increasing. Overall, after germination, POD activity was enhanced (Figure 2A). The expression level of ZmPOD1 was also higher than that of 20hi111 in T135, but the expression level of ZmPOD3 was higher than that of 20hi111 in T135 during the early stage of germination and lower than that of 20hi111 in the later stage, showing no significant correlation with the maize variety (Figure 4). Our results are consistent with previous studies, showing that POD enzyme activity is closely related to low-temperature germination, but not highly correlated with gene expression

[12]

. It is also possible that the ZmPOD3 gene is not a key low-temperature tolerant germination gene, as similar findings have been made in other studies

[28]

CAT is located in the mitochondria

[29]

, and during the cold acclimation period of maize, its increased activity is mainly concentrated in this organelle. Under low temperature conditions, the reactive oxygen species in mitochondria increase, and CAT can clear the reactive oxygen species in mitochondria, preventing the respiratory function of maize from being blocked

[30, 31]

. CAT enzyme has been reported to play an important role in cold acclimation and cold resistance of rice

[32]

. Low temperature stress increases the activities of SOD and CAT in cold resistant tobacco and increases their gene expression levels

[33]

. The isoenzymes of CAT mainly include CAT1, CAT2, CAT3, etc. Among them, maize CAT3 is a key enzyme that improves the cold resistance of maize and sequence analysis shows that CAT1 has a target sequence for peroxides

[34]

. The expression of CAT3 is enhanced during plant cold treatment, maintaining low levels of H₂O₂ in the body

[35]

. Our research shows that CAT activity first increases and then decreases during the germination process of sweet corn at room temperature, while CAT activity gradually increases at low temperatures (Figure 1B). Surprisingly, in 20hi111 at low temperatures, both CAT activity and CAT gene expression levels were higher than T135 (Figures 1, 3), showing results opposite to previous studies

[9]

. We speculate that this may be related to the stress response of plants to H₂O₂, inducing the expression of protective enzyme genes to clear reactive oxygen species induced by cold stress

[36]

. There are research reports that in plants, SOD enzyme is mainly used to clear peroxide anions, thereby producing oxygen and H₂O₂. H₂O₂ is further decomposed by POD and CAT

[37]

. At different stages of germination, different types of oxidases may contribute relatively differently to the clearance of reactive oxygen species

[38]

. Therefore, it is possible that CAT enzyme activity and gene expression may be lower than 20hi111 during the pre-germination or even germination period.

5. Conclusions

This study measured the MDA and H₂O₂ content, CAT, POD, and SOD enzyme activities, and the gene expression patterns of ZmSOD3, ZmSOD9, ZmPOD1, ZmPOD3, ZmCAT1, and ZmCAT3 during seed germination of chilling sensitive sweet corn inbred line 20hi111 and chilling tolerant sweet corn inbred line T135 under low temperature (10°C) and room temperature (25°C) treatments. The results showed that low-temperature treatment significantly increased the content of H₂O₂ and MDA in 20hi111 compared to T135. In 20hi111, the activities of POD and SOD were also significantly higher than T135, but the activity of CAT was significantly lower than T135. In terms of gene expression, at low temperatures, the expression levels of ZmSOD1 and ZmSOD3 were significantly lower than T135 in 20hi111, while there was no difference in ZmPOD1. In 20hi111, ZmPOD3 was first higher and then lower than T135, while ZmCAT1 and ZmCAT3 were significantly higher than T135. In this experiment, the content of H₂O₂ and MDA, as well as the activities of SOD and POD, can be used as identification indicators to determine the low-temperature germination tolerance of sweet corn seeds. Low levels of oxidation and high levels of SOD enzyme activity and gene expression may be the main reasons for T135's strong cold tolerance. Our research is beneficial for screening and creating seed resources that are tolerant to low temperature germination, which will contribute to the improvement of sweet corn breeding. In addition, our research provides a crucial theoretical basis for understanding the physiological and molecular biology mechanisms of low-temperature germination of sweet corn.

Abbreviations

MDA	Malondialdehyde
CAT	Catalase
POD	Peroxidase
SOD	Superoxide Dismutase
ROS	Reactive Oxygen Species
RT	Room Temperature Treatment
LT	Low Temperature Treatment
qRT-PCR	Quantitative Real-time PCR Analysis

Author Contributions

Tingzhen Wang: Writing – original draft, Writing – review & editing

Jianjian Chen: Software, Validation

Zhenxing Wu: Investigation, Resources

Fangjian Li: Resources, Writing – review & editing

Guihua Lv: Conceptualization, Supervision, Validation

Funding

This study received support from the National Key Research and Development Program (2023YFD1201105) and Key Research and Development Project of Zhejiang Province (2022C04024). The funding institution played no role in the study's design, data collection, analysis, interpretation, or manuscript preparation.

Data Availability Statement

The data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1]	Borowski, A. M., Fritz, V. A., Waters, L. Seed maturity influences of two shrunken-2 sweet germination and vigor corn hybrids. Journal of the American Society for Horticultural Science. 1991, 116(3), 401-404. https://doi.org/10.21273/JASHS.116.3.401
[2]	Sudjatmiko, S., Chozin, M. Phenological, growth, and yield responses of sweet corn to elevational air temperatures in the humid tropics. Australian Journal of Crop Science. 2024, 18(2), 92-98. https://doi.org/10.21475/ajcs.24.18.02.pne4072
[3]	Richard, L., Hassell, Robert, J., Dufault, Tyron, L., Phillips. Low-temperature Germination Response of su, se, and sh2 Sweet Corn Cultivars. Horttechnology. 2003, 13(1), 136-141. https://doi.org/10.21273/HORTTECH.13.1.0136
[4]	Li, J., Xu, J. G., Lin, C., Guan, Y. J., Hu, J. Effect of priming on germination and physiological characteristics of different types of corn seeds under low-temperature stress. Plant Physiology Journal. 2016, 52(2), 157-166. https://doi.org/10.13592/j.cnki.ppj.2015.0578
[5]	Wilson, Franklin, D. Stoichiometry and site specificity of the uncoupling of mitochondrial oxidative phosphorylation by salicylanilide derivatives. Biochemistry. 1969, 8(6), 2475. https://doi.org/10.1021/bi00834a033
[6]	Singh, A., Kumar, A., Yadav, S., Singh, I. K. Reactive oxygen species-mediated signaling during abiotic stress. Plant Gene. 2019, 18. https://doi.org/10.1016/j.plgene.2019.100173
[7]	Carocho, M., Ferreira, I. C. A review on antioxidants, prooxidants and related controversy: natural and synthetic compounds, screening and analysis methodologies and future perspectives. Food and Chemical Toxicology. 2013, 51, 15-25. https://doi.org/10.1016/j.fct.2012.09.021
[8]	Wu J. H., Yang L., Sun G. R. Generation of activated oxygen and change of cell defense enzyme activity in leaves of maize seedling under the stress of low temperature. Bulletin of Botanical Research. 2004, 24(4), 456-459. https://bbr.nefu.edu.cn/CN/Y2004/V24/I4/456
[9]	Zhang, H. Y. Effects of low temperature on seed germination and seedling growth of fresh corn. Plant Physiology Journal. 2013, 49(4), 347-350. https://doi.org/10.13592/j.cnki.ppj.2013.04.004
[10]	Ramazan, S., Qazi, H. A., Dar, Z. A., John, R. Low temperature elicits differential biochemical and antioxidant responses in maize (Zea mays) genotypes with different susceptibility to low temperature stress. Physiology and molecular biology of plants. 2021, 27(6): 1395-1412. https://doi.org/10.1007/s12298-021-01020-3
[11]	Wu, Z., Wang, T., Chen, J., Zhang, Y., Lv, G. Sweet corn association panel and genome-wide association analysis reveal loci for chilling-tolerant germination. Scientific reports. 2024, 14(1), 10791. https://doi.org/ 10.1038/s41598-024-61797-7
[12]	Jing, Y., Jihua, M., Yongtao, Y. U., Chunyan, L. I., Yongfei, W., Jianguang, H. U. Effects of Chilling on Antioxidant Enzyme Activity and Related Gene Expression Levels During Seed Germination. Journal of Nuclear Agricultural Sciences. 2016. https://doi.org/10.11869/j.issn.100-8551.2016.09.1840
[13]	Souza, D., RS, Vidigal, PS, Scapim, CA, Marques, OJ, Queiroz, DC. Yield and quality of sweet corn at different plant populations. Semin Cienc Agrar. 2013. https://doi.org/10.5433/1679-0359.2013v34n3p995
[14]	Storck, L., Lovato, C., Comassetto, V. Avaliação do rendimento e outras características agronômicas de cultivares de milho doce. Revista Do Centro De Ciências Rurais. 2008, 14(4). https://periodicos.ufsm.br/revccr/article/view/73093
[15]	Cutforth, H. W., Shaykewich, C. F. A temperature response function for corn development. Agricultural and Forest Meteorology. 1990, 50(3), 159-171. https://doi.org/10.1016/0168-1923(90)90051-7
[16]	Ramazan, S., Jan, N., John, R. Comparative protein analysis of two maize genotypes with contrasting tolerance to low temperature. BMC Plant Biology. 2023, 23(1). https://doi.org/10.1186/s12870-023-04198-8
[17]	C, K. A., Nalbanto Lu, B. Antifreeze proteins in higher plants. Phytochemistry. 2003, 64(7), 1187-1196. https://doi.org/10.1016/S0031-9422(03)00420-5
[18]	Xu, P. L., Guo, Y. K., Bai, J. G., Shang, L., Wang, X. J. Effects of long-term chilling on ultrastructure and antioxidant activity in leaves of two cucumber cultivars under low light. Physiologia plantarum. 2008, 132(4), 467-478. https://doi.org/10.1111/j.1399-3054.2007.01036.x
[19]	Taşgín, E., Atící, Ö., Nalbantoğlu, B. Effects of salicylic acid and cold on freezing tolerance in winter wheat leaves. Plant Growth Regulation. 2003, 41(3), 231-236. https://doi.org/10.1023/B:GROW.0000007504.41476.c2
[20]	Janero, D. R. Malondialdehyde and thiobarbituric acid-reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radical Biology & Medicine. 1990, 9(6), 515-540. https://doi.org/10.1016/0891-5849(90)90131-2
[21]	Wattanakulpakin, P., Photchanachai, S., Miyagawa, S., Ratanakhanokchai, K. Loss of Maize Seed Vigor as Affected by Biochemical Changes during Hydropriming. Science. 2012, 52(6), 2783. https://doi.org/10.2135/cropsci2012.02.0089
[22]	Li, C. Z., Jiao, J., Wang, G. X. The important roles of reactive oxygen species in the relationship between ethylene and polyamines in leaves of spring wheat seedlings under root osmotic stress. Plant Science. 2004, 166(2), 303-315. https://doi.org/10.1016/j.plantsci.2003.09.019
[23]	Yu, J. D. Y. S. Physiological basis of different allelopathic reactions of cucumber and figleaf gourd plants to cinnamic acid. Journal of Experimental Botany. 2007, 58(13), 3765-3773. https://doi.org/10.1093/jxb/erm227
[24]	Río, L. A. D., Corpas, F. J., López-Huertas, E., Palma, J. M. Plant Superoxide Dismutases: Function Under Abiotic Stress Conditions, Antioxidants and Antioxidant Enzymes in Higher Plants. 2018. pp: 1-26.
[25]	Guan, L., Scandalios, J. G. Two Structurally Similar Maize Cytosolic Superoxide Dismutase Genes, Sod4 and Sod4A, Respond Differentially to Abscisic Acid and High Osmoticum 1. Plant Physiology. 1998. https://doi.org/10.1104/pp.117.1.217
[26]	Scandalios, J., G. Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Brazilian Journal of Medical and Biological Research. 2005, 38(7), 995-1014. https://doi.org/10.1590/s0100-879x2005000700003
[27]	Willekens, H., Inzé, D., Montagu, M. V., Camp, W. V. Catalases in plants. Molecular Breeding. 1995, 1(3), 207-228. https://doi.org/10.1007/BF02277422
[28]	Redinbaugh, M. G., Sabre, M., Scandalios, J. G. The Distribution of Catalase Activity, Isozyme Protein, and Transcript in the Tissues of the Developing Maize Seedling. Plant Physiology. 1990, 92, 375-380. https://doi.org/10.1104/pp.92.2.375
[29]	Puntarulo, S., Sanchez, R. A., Boveris, A. Hydrogen Peroxide Metabolism in Soybean Embryonic Axes at the Onset of Germination. Plant Physiology. 1988, 86(2), 626-630. https://doi.org/10.1104/pp.86.2.626
[30]	Puntarulo, S., Galleano, M., Sanchez, R. A., Boveris, A. Superoxide anion and hydrogen peroxide metabolism in soybean embryonic axes during germination. Biochimica et Biophysica Acta (BBA) - General Subjects. 1991, 1074(2), 277-83. https://doi.org/10.1016/0304-4165(91)90164-c
[31]	Bethards, L. A., Skadsen, R. W., Scandalios, J. G. Isolation and characterization of a cDNA clone for the Cat2 gene in maize and its homology with other catalases. Proceedings of the National Academy of Sciences. 1987, 84(19), 6830-6834. https://doi.org/10.1073/pnas.87.17.6927
[32]	Kuk, Y. I., Shin, J. S., Burgos, N. R., Hwang, T. E., Han, O., Cho, B. H., Jung, S., Guh, J. O. Antioxidative Enzymes Offer Protection from Chilling Damage in Rice Plants. Crop Science. 2003, 43(6). https://doi.org/10.2135/cropsci2003.2109
[33]	Hodges, D. M., Andrews, C. J., Johnson, D. A., Hamilton, R. I. Antioxidant enzyme responses to chilling stress in differentially sensitive inbred maize lines. Journal of Experimental Botany. 1997, 5, 5. https://doi.org/10.1034/j.1399-3054.1996.980402.x
[34]	Abler, M. L. Isolation and characterization of a genomic sequence encoding the maize Cat3 catalase gene. Plant Molecular Biology. 1993, 22(6), 1031-1038. https://doi.org/10.1007/BF00028975
[35]	Han-Mei, L., Huai-Yu, Z., Zhen-Bo, T., Yu-Bi, H. Isolation and Expression of the Genes Involved in Tolerance to Low Temperature in Maize. Journal of Maize Sciences. 2007. http://www.ymkx.com.cn/jms/article/abstract/07020026?st=article_issue
[36]	Kratsch, H. A., Wise, R. R. The ultrastructure of chilling stress. Plant Cell & Environment. 2000, 23(4), 337-350. https://doi.org/10.1046/j.1365-3040.2000.00560.x
[37]	Miyake, C., Asada, K. Ferredoxin-Dependent Photoreduction of the Monodehydroascorbate Radical in Spinach Thylakoids. Plant & Cell Physiology. 1994, 35(4), 539-549. https://doi.org/10.1093/oxfordjournals.pcp.a078628
[38]	Tsang, E. W., Bowler, C., Hérouart, D., Van Camp, W., Villarroel, R., Genetello, C., Van Montagu, M., Inzé, D. Differential regulation of superoxide dismutases in plants exposed to environmental stress. The Plant Cell. 1991, 3(8), 783-92. https://doi.org/10.2307/3869272

Cite This Article

Plain Text BibTeX RIS

APA Style

Wang, T., Wu, Z., Chen, J., Li, F., Lv, G. (2024). The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics. Agriculture, Forestry and Fisheries, 13(6), 224-234. https://doi.org/10.11648/j.aff.20241306.11

Copy | Download

ACS Style

Wang, T.; Wu, Z.; Chen, J.; Li, F.; Lv, G. The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics. Agric. For. Fish. 2024, 13(6), 224-234. doi: 10.11648/j.aff.20241306.11

Copy | Download

AMA Style

Wang T, Wu Z, Chen J, Li F, Lv G. The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics. Agric For Fish. 2024;13(6):224-234. doi: 10.11648/j.aff.20241306.11

Copy | Download

@article{10.11648/j.aff.20241306.11,
  author = {Tingzhen Wang and Zhenxing Wu and Jianjian Chen and Fangjian Li and Guihua Lv},
  title = {The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics
},
  journal = {Agriculture, Forestry and Fisheries},
  volume = {13},
  number = {6},
  pages = {224-234},
  doi = {10.11648/j.aff.20241306.11},
  url = {https://doi.org/10.11648/j.aff.20241306.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.aff.20241306.11},
  abstract = {Sweet corn is a vegetable and grain dual-use crop with high economic value and industrial advantages. Low temperature stress significantly reduces the germination rate of sweet corn seeds, which has a negative impact on both quality and yield. This study used the chilling sensitive sweet corn inbred line 20hi111 and the chilling tolerant sweet corn inbred line T135 as experimental materials to measure the MDA (malondialdehyde) and H2O2 content, CAT, POD, and SOD enzyme activities, and enzyme gene expression patterns during seed germination under low temperature (10°C) and normal temperature (25°C) treatments. The research results indicated that during low-temperature germination, the H2O2 content and CAT activity of 20hi111 were generally higher than those of T135, while the POD and SOD activities and MDA content were generally lower than those of T135. There was no strict consistency between gene expression and enzyme activity. At low temperature, the expression of ZmCAT1 and ZmCAT3 in 20hi111 was significantly higher than T135, while there was no significant difference in ZmPOD1. In 20hi111, ZmPOD3 was first lower and then higher than T135, and ZmSOD3 and ZmSOD9 were lower than T135 under low temperature treatment. In this study, the activity of antioxidant enzymes and the expression of antioxidant enzyme-related genes in sweet corn inbred lines with different germination characteristics under low temperature were analyzed, which provided some theoretical basis for cultivating sweet corn varieties with low temperature tolerance.
 },
 year = {2024}
}

Copy | Download

TY  - JOUR
T1  - The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics

AU  - Tingzhen Wang
AU  - Zhenxing Wu
AU  - Jianjian Chen
AU  - Fangjian Li
AU  - Guihua Lv
Y1  - 2024/11/21
PY  - 2024
N1  - https://doi.org/10.11648/j.aff.20241306.11
DO  - 10.11648/j.aff.20241306.11
T2  - Agriculture, Forestry and Fisheries
JF  - Agriculture, Forestry and Fisheries
JO  - Agriculture, Forestry and Fisheries
SP  - 224
EP  - 234
PB  - Science Publishing Group
SN  - 2328-5648
UR  - https://doi.org/10.11648/j.aff.20241306.11
AB  - Sweet corn is a vegetable and grain dual-use crop with high economic value and industrial advantages. Low temperature stress significantly reduces the germination rate of sweet corn seeds, which has a negative impact on both quality and yield. This study used the chilling sensitive sweet corn inbred line 20hi111 and the chilling tolerant sweet corn inbred line T135 as experimental materials to measure the MDA (malondialdehyde) and H2O2 content, CAT, POD, and SOD enzyme activities, and enzyme gene expression patterns during seed germination under low temperature (10°C) and normal temperature (25°C) treatments. The research results indicated that during low-temperature germination, the H2O2 content and CAT activity of 20hi111 were generally higher than those of T135, while the POD and SOD activities and MDA content were generally lower than those of T135. There was no strict consistency between gene expression and enzyme activity. At low temperature, the expression of ZmCAT1 and ZmCAT3 in 20hi111 was significantly higher than T135, while there was no significant difference in ZmPOD1. In 20hi111, ZmPOD3 was first lower and then higher than T135, and ZmSOD3 and ZmSOD9 were lower than T135 under low temperature treatment. In this study, the activity of antioxidant enzymes and the expression of antioxidant enzyme-related genes in sweet corn inbred lines with different germination characteristics under low temperature were analyzed, which provided some theoretical basis for cultivating sweet corn varieties with low temperature tolerance.
 
VL  - 13
IS  - 6
ER  -

Copy | Download

Author Information

Tingzhen Wang

Institute of Maize and Featured Upland Crops, Zhejiang Academy of Agricultural Sciences, Dongyang, China

http://orcid.org/0000-0003-1154-054X
Zhenxing Wu

Institute of Maize and Featured Upland Crops, Zhejiang Academy of Agricultural Sciences, Dongyang, China
Jianjian Chen

Institute of Maize and Featured Upland Crops, Zhejiang Academy of Agricultural Sciences, Dongyang, China
Fangjian Li

Institute of Maize and Featured Upland Crops, Zhejiang Academy of Agricultural Sciences, Dongyang, China
Guihua Lv

Institute of Maize and Featured Upland Crops, Zhejiang Academy of Agricultural Sciences, Dongyang, China

Contact Email

Download PDF

Submit an Article

Table 1

Table 1. The primer list.

Plain Text BibTeX RIS

APA Style

Wang, T., Wu, Z., Chen, J., Li, F., Lv, G. (2024). The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics. Agriculture, Forestry and Fisheries, 13(6), 224-234. https://doi.org/10.11648/j.aff.20241306.11

Copy | Download

ACS Style

Wang, T.; Wu, Z.; Chen, J.; Li, F.; Lv, G. The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics. Agric. For. Fish. 2024, 13(6), 224-234. doi: 10.11648/j.aff.20241306.11

Copy | Download

AMA Style

Wang T, Wu Z, Chen J, Li F, Lv G. The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics. Agric For Fish. 2024;13(6):224-234. doi: 10.11648/j.aff.20241306.11

Copy | Download

@article{10.11648/j.aff.20241306.11,
  author = {Tingzhen Wang and Zhenxing Wu and Jianjian Chen and Fangjian Li and Guihua Lv},
  title = {The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics
},
  journal = {Agriculture, Forestry and Fisheries},
  volume = {13},
  number = {6},
  pages = {224-234},
  doi = {10.11648/j.aff.20241306.11},
  url = {https://doi.org/10.11648/j.aff.20241306.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.aff.20241306.11},
  abstract = {Sweet corn is a vegetable and grain dual-use crop with high economic value and industrial advantages. Low temperature stress significantly reduces the germination rate of sweet corn seeds, which has a negative impact on both quality and yield. This study used the chilling sensitive sweet corn inbred line 20hi111 and the chilling tolerant sweet corn inbred line T135 as experimental materials to measure the MDA (malondialdehyde) and H2O2 content, CAT, POD, and SOD enzyme activities, and enzyme gene expression patterns during seed germination under low temperature (10°C) and normal temperature (25°C) treatments. The research results indicated that during low-temperature germination, the H2O2 content and CAT activity of 20hi111 were generally higher than those of T135, while the POD and SOD activities and MDA content were generally lower than those of T135. There was no strict consistency between gene expression and enzyme activity. At low temperature, the expression of ZmCAT1 and ZmCAT3 in 20hi111 was significantly higher than T135, while there was no significant difference in ZmPOD1. In 20hi111, ZmPOD3 was first lower and then higher than T135, and ZmSOD3 and ZmSOD9 were lower than T135 under low temperature treatment. In this study, the activity of antioxidant enzymes and the expression of antioxidant enzyme-related genes in sweet corn inbred lines with different germination characteristics under low temperature were analyzed, which provided some theoretical basis for cultivating sweet corn varieties with low temperature tolerance.
 },
 year = {2024}
}

Copy | Download

TY  - JOUR
T1  - The Effects of Chilling on Antioxidant Enzyme System and Related Gene Expression Levels in Sweet Corn Seeds with Different Germination Characteristics

AU  - Tingzhen Wang
AU  - Zhenxing Wu
AU  - Jianjian Chen
AU  - Fangjian Li
AU  - Guihua Lv
Y1  - 2024/11/21
PY  - 2024
N1  - https://doi.org/10.11648/j.aff.20241306.11
DO  - 10.11648/j.aff.20241306.11
T2  - Agriculture, Forestry and Fisheries
JF  - Agriculture, Forestry and Fisheries
JO  - Agriculture, Forestry and Fisheries
SP  - 224
EP  - 234
PB  - Science Publishing Group
SN  - 2328-5648
UR  - https://doi.org/10.11648/j.aff.20241306.11
AB  - Sweet corn is a vegetable and grain dual-use crop with high economic value and industrial advantages. Low temperature stress significantly reduces the germination rate of sweet corn seeds, which has a negative impact on both quality and yield. This study used the chilling sensitive sweet corn inbred line 20hi111 and the chilling tolerant sweet corn inbred line T135 as experimental materials to measure the MDA (malondialdehyde) and H2O2 content, CAT, POD, and SOD enzyme activities, and enzyme gene expression patterns during seed germination under low temperature (10°C) and normal temperature (25°C) treatments. The research results indicated that during low-temperature germination, the H2O2 content and CAT activity of 20hi111 were generally higher than those of T135, while the POD and SOD activities and MDA content were generally lower than those of T135. There was no strict consistency between gene expression and enzyme activity. At low temperature, the expression of ZmCAT1 and ZmCAT3 in 20hi111 was significantly higher than T135, while there was no significant difference in ZmPOD1. In 20hi111, ZmPOD3 was first lower and then higher than T135, and ZmSOD3 and ZmSOD9 were lower than T135 under low temperature treatment. In this study, the activity of antioxidant enzymes and the expression of antioxidant enzyme-related genes in sweet corn inbred lines with different germination characteristics under low temperature were analyzed, which provided some theoretical basis for cultivating sweet corn varieties with low temperature tolerance.
 
VL  - 13
IS  - 6
ER  -

Copy | Download